AdamsX
AdamsX AdamsX
  • 02-08-2018
  • Mathematics
contestada

Can someone help me with this 4x+6=2x+10

Respuesta :

anubhat046 anubhat046
  • 02-08-2018

So if you are solving for x we have to do this
4x+6=2x+10
4x-2x=10-6
2x=4
x=4/2
x=2

Answer Link

Otras preguntas

Solve the following system of equations for all three variables.-8x – 3y + 5z = -2X-2y – 5z = -94x + 7y + 5z = 4
Aurelia went to the doctor’s office. The nurse measured her height as 44 inches. If Aurelia needs to be 4 1/2 feet to ride an amusement park ride, how many more
What is the value of x in the diagram below? х 15 7 20 0 15 0 24 26 0 28
3. A toy box is 24 cm long, 15 cm wide and 11 cm high. What is the volume of the toy box? What is the correct number sentence for this problem? A.V=24×15×11B.V=
D what is the image pointof (3-4) after a translationleft 2 units and up 2 units?
if ZQPS is a right angle and mLQPR = 71 ° . what is mZRPS
1. Which of the following is the value of -13 - 51 – 3? (A) -5 (B) -1 (C) 0 (D) 1 M
To factor 9x^2 - 4, you can first rewrite the expression as: A. (3x-2)^2B. (x)^2 - (2)^2C. (3x)^2 - (2)^2D. None of the above
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
Write a quadratic equation with 7 and 2/5 as its roots. Write the equation in the form ax2 + bx+c= 0, where a, b, and c are integers.