gmtmak2009 gmtmak2009
  • 03-11-2019
  • Mathematics
contestada

Nancy walked 1.7 miles in 1 hour. if she walks at the same rate, how far will she walk in 1.9 hours? in 1.8 hours?​

Respuesta :

celinafan
celinafan celinafan
  • 03-11-2019
1.7x1.9=3.23, 1.7x1.8=3.06, hope that helps!
Answer Link

Otras preguntas

4.2meters= how many centimeter
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
what is the most common type of vegetation throughout Latin America
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Do you think then solid can undergo convection
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea