fabiolapedroza16 fabiolapedroza16

02-06-2020
History

contestada

what three territories of the united states were involved in border disputes with other countries

Respuesta :

carlavela0 carlavela0

02-06-2020

Answer:

There were lots

Explanation:

Four types of boundary dispute can arise: (1) positional disputes; (2) territorial disputes; (3) cultural disputes; and (4) resource disputes

Answer Link

Otras preguntas

Which expression is equivalent to (5)^7/3

with whom does odysseus conspire to retake control of his home ? what are Antinous and the other doing in odysseus's house? How does Penelope test odysseus to m

Which table shows a proportional relationship between x and y?

Design a logo for yourself or a fictional company using a variety of transformations. Describe each of the transformations you used to create your logo. (image

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

one of these early hindu writings, the atharva veda, speaks of an archer's bow made of sugar cane. it tells of growing a circle of sugar cane as a kind of sweet

Elon Musk's work with Neuralink is his most ambitious because... A he is trying to help paraplegics recover the use of their own limbs. B he is trying to create

What were citizens upset about in the Yazoo Land Fraud?

Families do not perform similar functions across cultures. Please select the best answer from the choices provided OT O F

Bro someone help me pls I will Give brainlist to the best answer :)