bruiktucker bruiktucker
  • 03-09-2020
  • French
contestada

Which is the largest ethnic group in Guinea?

Respuesta :

Аноним Аноним
  • 03-09-2020

Answer:

the Fulani, Malinké, and Soussou.

Explanation:

Answer Link

Otras preguntas

Why does Helen go to bed happy at the end of the chapter?
[tex]Let \: \: f(x)= [ \dfrac{ \sin(x) }{x} ] + [ \dfrac{ 2\sin(2x) }{x} ] + \: ... \: [ \dfrac{ 10\sin(10x) }{x} ] \\ \\ Where \: [y] \: is \: the \: largest \
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
In "no witchcraft for sale," why are the farquars particularly happy when teddy is born?
A rectangle has an area of 384 m. The length and the width of a rectangle are changed by a scale factor of 0.75. What is the area of the new triangle
What is the area of this composed figure
A mixture from which some of the particles settle out slowly upon standing
A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil
Which of the following have at least two congruent parallel bases? all that apply. A. Cylinder B. Circle C. Cone D. Cube E. None of these F
A guitarist uses ________ to recall how to play the notes of a specific song. episodic memory procedural memory semantic memory a flashbulb memory