Seudónimo Seudónimo
  • 01-10-2020
  • Mathematics
contestada

An object is a regular, rectangular, solid with dimensions of 2 cm by 3cm by 2cm. It has a mass of 24 g. Find its density

Respuesta :

crystal3603813
crystal3603813 crystal3603813
  • 01-10-2020

Answer:

2 g/cm³

Step-by-step explanation:

The volume is not given, so find that first:

2 cm x 3 cm x 2 cm = 12 cubic cm = V

Mass is given: m = 24 g

Using the density formula, solve:

d = m/V

d = 24 g/12 cubic cm

d = 2 g/cubic cm

Answer Link

Otras preguntas

What is the value of x?
Personal care quiz---when providing nail care it is important to consult a professional true or false
20% of what number is equal to 2/3 of 90?
The transtheoretical model includes a stage called termination. a. True b. False
Which of the following can be a cause of social change?
distillation definition chemistry
A child finds 30 nickels and dimes between sofa cushions. how many dimes did the child find if the total value of the coins is $1.90?
Explain the carbon cycle and explain why burning fossil fuels is an issue.
Help with these 4 questions please and thanks!!! 1. Find the radius of the circle x2 + 8x - 4 + y2 + 2y = 12 A. 9 B. 3 C. 5 D. 25 2. Find the center and radius
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat