patinoyordani10
patinoyordani10 patinoyordani10
  • 01-12-2020
  • History
contestada

Define Cash Crops in 5 words or less​

Respuesta :

miahsanders
miahsanders miahsanders
  • 01-12-2020
Crop produced for commercial value.
Answer Link
MadHatter05022007 MadHatter05022007
  • 01-12-2020

Answer:

Grown to sell for profit.

Answer Link

Otras preguntas

Please help me!! I need to get this right to pass ASAP 1. Isosceles trapezoid TRAP is shown below. What are the coordinates of point T? (-4a, 0) (-b, 0) (0, -4a
You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis
A major weakness of the new constitution was the bill of rights. a. True b. False
4 (2x-6)=10x-6. solve for x
True or False. An object's mass will change if you move it from the Earth to the Moon.
For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile
what is 3(2x-4)=5x+2
According to engels, what purpose did government serve? a. to organize production c. to create new jobs b. to revolt against workers d. to pass laws ending oppr
Write the equation of the line containing the point (1 2) and parallel to the line 2x + 4y = 1
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat