25bahano 25bahano

01-12-2020
Mathematics

contestada

Write a linear function f with the values f(−1)=8 and f(5)=6.

Respuesta :

klandsman560 klandsman560

02-12-2020

Answer:

f(x)=-1/3x+7 2/3

Step-by-step explanation:

Find the slope:

m= -1/3

Find the y-intercept:

b= -7 2/3

Answer Link

Otras preguntas

Can someone Help me with that please

Find the area bounded by the curves x = y2 - 4y and x = 2y - y2. Your work must include an integral in one variable.

The ___ project was the top secret project tasked with developing atomic weapons in the United States? A. Philadelphia B. Manhattan C. Nuclear D. Hiroshima

Firms can use one, no more than two, of five entry modes to enter into international markets. Exporting, Licensing, Strategic Alliances, Acquisitions, and newly

I just need help with the equation part since when I keep doing I get the wrong answer.

When you prepare to make a left turn from a one-way road into a two-way road, you must:?

The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?

cody has 7/8 pound of cheese. he uses 1/7 since there are 16 ounces in a pound how much is left

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If XY=18, YZ=14, and XZ=20, find the radius of each circle.