crazyluhtori
crazyluhtori crazyluhtori
  • 03-12-2020
  • History
contestada

How does the Atlantic slave trade impact the world

Respuesta :

maxbinom20
maxbinom20 maxbinom20
  • 03-12-2020

Answer:

The implications of the slave trade included:

Effects of the trade on African societies in West Africa

The slave sellers and European ‘factories’ on the West African coast

The development of slave-based states and economies

The destruction of societies

The development of foreign colonies

Leaders of African societies took roles in continuing the trade

Answer Link

Otras preguntas

English is a very useful language. If we (13)........... English, we can go to any countries we like. We will not find it hard to make people understand (14) ..
explain why you think the solar system could or could not have been formed without gravity
PLS HELPA! Which procedure could be used to demonstrate that matter is conserved during a physical change? A. Find the mass of a raw egg, Cook the egg. Find the
Compare the pressure exerted by the liquid at points A, B and C. Justify your answer
Why are prepositions important? a. They identify the little words in a sentence b. They clarify relationships in a sentence c. The identify the words that class
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
its about the middle passage
18x^2 −3 will give brailiest
Please help serious answers only
In the figure below,