pattylina09
pattylina09 pattylina09
  • 03-12-2020
  • Geography
contestada

All of the stars in a given constellation are about the same distance away from Earth.
O True
O False

Respuesta :

jasperks jasperks
  • 03-12-2020
It’s false because the stars are alll different distances from earth. The stars in a constellation appear to be in the same plane because we are reviewing them from very very far away
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow
how would u form a superlative for the adverb widely
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
What statement best describes a republic?
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
Fossils are most commonly found in which type of rock?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y