jaynerourke jaynerourke
  • 03-02-2021
  • Mathematics
contestada

[tex]X=\sqrt{x} 432[/tex]

Respuesta :

avbq775r3b
avbq775r3b avbq775r3b
  • 03-02-2021
X^216 that is simplified.
Answer Link

Otras preguntas

Find the simple interest earned by each account. $800 principal at 4% interest for 5 years
Find the value of x. pls hurry big reward.
Switches should always be wired on the hot side of a circuit. True or False??
1 Point Which graph shows the line y - 4 = 3(x + 1)? O A. Graph B O B. Graph c O C. Graph A O D. Graph D
What is the common ratio of the sequence? -2, 6, -18, 54,... 0 -3 O -2 3 08
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
What were the problems with the crittenden compromise plan?
Simplify the expression -2(p+4)^2-3+5p what is the simplified expression in standard form?
To be identified as a market segment, members of the group must Multiple Choice have the potential for future growth and increased profit or ROI. have diverse n
Tanner-UNF Corporation acquired as a long-term investment $240 million of 7% bonds, dated July 1, on July 1, 2018. The market interest rate (yield) was 9% for b