upalupa81 upalupa81
  • 04-02-2021
  • Mathematics
contestada

Plz help me thanks to who ever answers

Plz help me thanks to who ever answers class=

Respuesta :

aher4062 aher4062
  • 04-02-2021

Answer:

38 quarts

Step-by-step explanation:

Answer Link

Otras preguntas

What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
How do I do trebuchet calculations????? Help me please
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Graph the first six terms of a sequence where a1 = -10 and d = 3.
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
The section of the small intestine between the duodenum and ilium?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5