griffinquy griffinquy
  • 01-03-2021
  • Mathematics
contestada

what is the value of 1/4 to the third power

Respuesta :

00072178
00072178 00072178
  • 01-03-2021

Answer:

0.015625

Step-by-step explanation:

Answer Link
mcolethompson7705
mcolethompson7705 mcolethompson7705
  • 01-03-2021
The answer ie 0.015625
Answer Link

Otras preguntas

Help with geometry!!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Occurs/Exists when the owner-manager makes all major decisions and monitors all activities while the staff serves as an extension of the managers supervisory a
Mi abuelo no es joven. Es _____
Quadrilateral abcd is inscribed in this circle. what is the measure of angle a?
Which geographic characteristics makes Washington such an important state for international trade? A. It's distance from Canada and Mexico B. It's location on t
Identify the specific sensory receptors for each of the five common senses.
How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti
The reason why vanessa did not include sports skills activities in her program was that she: