sarahcruz8926 sarahcruz8926

03-04-2021
Biology

contestada

Respiration occurs
A-With oxygen
B-Without oxygen
C-In Eukaryotic cells
D-None of the above
E-All of the Above

Respuesta :

kaisersriprad kaisersriprad

03-04-2021

Answer:

Letter A

Explanation:

Respiration means to breathe and we breath oxygen and without it we will die.

Answer Link

ricopacifico95 ricopacifico95

03-04-2021

Answer:

A. with oxygen

Explanation:

Sana makatulong

Answer Link

Otras preguntas

which nutrition provides the highest number of calories per grama)fatb)proteinc) carbohydrated)suger

how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Why do you think James Meredith continued his march, even after he was shot?

Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -

The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1

[tg.02]carbon in food molecules is transferred from animals to the geosphere through the process of

The substance in the digestive system that lubricates moistens and protects the surface of the lumen is

Which two sets of lines in the poem illustrate that death's power is an illusion? Sonnet 10 by John Donne Death, be not proud, though some have called thee Mig

help me asap !!!!!!!!