naiiiia9119 naiiiia9119
  • 05-05-2021
  • Health
contestada

I need help please ASAPPPP???!!!!!!

I need help please ASAPPPP class=

Respuesta :

L19
L19 L19
  • 05-05-2021
BMI is Body mass index :)
Answer Link
gae35 gae35
  • 05-05-2021
it’s choice bbbbbbbbb !
Answer Link

Otras preguntas

The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was
6. Rewrite each of the following durations using eighth notes. Write in words and as a fraction: a. 1 quarter note b. 1 half note c. 1 full note
the volume of a sphere is 2254 pi ^3 what is the surface area of the sphere
Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf
There is no universally agreed-upon definition of cultural competence.
Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D. A
The montreal school of scholars have drawn together a still-growing framework about the ways in which communication constitutes organization.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Many worship services include a speech given by a church leader. this speech is called a
What distinguished the bantu religion from buddhism, christianity, and islam?