thelizardgamer1234 thelizardgamer1234
  • 04-07-2022
  • History
contestada

What is our main source for African history prior to European colonization in sub-Saharan West Africa?

Respuesta :

Studysmart100 Studysmart100
  • 05-07-2022

Answer:

I think the answer Is Egyptians, and Greek texts or documentation. I would also say Earlier Civilizations. For example the Mayans practiced slavery.

Explanation:

I hope this helps! Correct me if I am wrong.

Answer Link

Otras preguntas

which nutrition provides the highest number of calories per grama)fatb)proteinc) carbohydrated)suger
Find the area bounded by the curves x = y2 - 4y and x = 2y - y2. Your work must include an integral in one variable.
When a red blood cell is placed in hypotonic (very dilute) solutions of nacl?
El clima de la costa Guatemalteca es tropical, es decir es ______________________.
The stroop effect demonstrates people's inability to ignore the ______ of words.
What advice would you give someone whose life dream is to become a judge?
Please help!!!! URGENT!!!!!!!!!!!!!!!!!!!!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
World population is approximately upper p equals 6.4 left-parenthesis 1.0126 right-parenthesis superscript t, with upper p in billions and t in years since 2004
Virginia is 7-years old. georgia is 14 years old. both girls like to write short stories