hannahcolleen9199 hannahcolleen9199
  • 04-09-2017
  • Social Studies
contestada

The first guideline in critical thinking is to be curious and ask questions. once you've raised a general question, the next step is to:

Respuesta :

W0lf93
W0lf93 W0lf93
  • 13-09-2017
The next step is to DEFINE YOUR TERMS. Then find an appropriate and satisfying answer that would be meaningful enough to match the question, not just making any useless and unmeaning answer match the aroused question anyhow. After getting an appropriate answer, I'd move on to research more things on the subject which I'm working on now.
Answer Link

Otras preguntas

describe five ways to set strategy for effectively gathering patients information
What is the value of x?
What major events led to the establishment of the navy and the department of the navy?
How did the Hellenistic kings spread Greek culture
What advice would you give someone whose life dream is to become a judge?
If a family has three children, what is the probability that the family has at least one girl?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Let f(x) = x+7 and g(x) = x-4 Find f(x) times g(x)
When a circular pizza is cut into six slices using diameters, the total length of the cuts is 18 cm. what is the area of the pizza in square centimeters?
Why were senators able to amass more power and influence than congressmen during the gilded age?